|
Eurofins
wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops ![]() Wildtype Or Mutant (Ggagcagacgatggcgtcgctcc) Pp7 Stem–Loops, supplied by Eurofins, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops/product/Eurofins Average 90 stars, based on 1 article reviews
wildtype or mutant (ggagcagacgatggcgtcgctcc) pp7 stem–loops - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Nucleic Acids Research
Article Title: Visualization and characterization of RNA–protein interactions in living cells
doi: 10.1093/nar/gkab614
Figure Lengend Snippet: Development of the RNA fluorescence three-hybrid assay (rF3H) for RNA–protein interaction studies. ( A ) Principle of the rF3H assay. Three components for the assay, RNA of interest, protein of interest and an RNA trap, are triply expressed in cells containing lacO array on the genome. Tagged with ms2 stem–loop structures, the RNA of interest is recruited and anchored to the lacO loci by the RNA trap, the protein of interest therefore is enriched at the lacO loci by interacting with the RNA of interest, and the interaction between the protein and RNA can be visualized as co-localization of the fused red and green fluorescent proteins. ( B ) Image examples of pp7 RNA-PCP interaction visualized by rF3H. The RNA trap marked by EGFP was anchored at the lacO array and visualized as a nuclear fluorescent spot (EGFP channel, marked by filled arrowhead), and the mCherry labeled PCP (PCP-mCherry) was recruited to the lacO spot specifically in the presence of pp7 RNA (lower panel, marked by filled arrowhead), but neither in the mutant pp7 group nor in the control group (mCherry channel of the upper and middle panels, marked by open arrowhead). Merge channels were enhanced for clarity purposes. Scale bars are 10 μm. ( C ) Quantification of the relative mCherry signal at the lacO array. The presence of pp7 RNA leads to a significant fluorescence enhancement at the lacO spot compared with no RNA or only ms2 RNA condition. Data are presented as mean ± S.D., -RNA, n = 23; +ms2, n = 25; +ms2-pp7, n = 24, +ms2-pp7m, n = 26. *** P < 0.001.
Article Snippet: After that, 4 of 6 times ms2 stem–loops were replaced by 4 times of wildtype or mutant (GGAGCAGACGATGGCGTCGCTCC, synthesized by
Techniques: Fluorescence, Hybrid Assay, Labeling, Mutagenesis, Control